Este es un articulo acerca como una cepa del virus de la Influenza origino la famosa gripe aviar que fue tan famoso hace algunos años. Espero lo disfruten, lo pongo en ingles y en castellano.
Short
Communication
Intersegmental recombination between the
haemagglutinin and matrix genes was responsible
for the emergence of a highly pathogenic H7N3
avian influenza virus in British Columbia
John Pasick,1 Katherine Handel,1 John Robinson,2 John Copps,1
Deidre Ridd,1 Kevin Hills,1 Helen Kehler,1 Colleen Cottam-Birt,1
James Neufeld,1 Yohannes Berhane1 and Stefanie Czub1
Correspondence
John Pasick
[email protected]
1Canadian Food Inspection Agency, National Centre for Foreign Animal Disease, 1015
Arlington Street, Winnipeg, Manitoba, Canada R3E 3M4
2Animal Health Centre, British Columbia Ministry of Agriculture and Food, 1767 Angus
Campbell Road, Abbotsford, British Columbia, Canada V3G 2M3
Received 28 July 2004
Accepted 30 November 2004
In February 2004 a highly pathogenic avian influenza (HPAI) outbreak erupted in British
Columbia. Investigations indicated that the responsible HPAI H7N3 virus emerged suddenly
from a low pathogenic precursor. Analysis of the haemagglutinin (HA) genes of the low and high
pathogenic viruses isolated from the index farm revealed the only difference to be a 21 nt insert
at the HA cleavage site of the highly pathogenic avian influenza virus. It was deduced that this
insert most probably arose as a result of non-homologous recombination between the HA and
matrix genes of the same virus. Over the course of the outbreak, a total of 37 isolates with, and
3 isolates without inserts were characterized. The events described here appear very similar to
those which occurred in Chile in 2002 where the virulence shift of another H7N3 virus was
attributed to non-homologous recombination between the HA and nucleoprotein genes.
Avian influenza manifests itself in domestic poultry in two
distinct ways, depending on the virulence of the strain
involved. Low pathogenic avian influenza (LPAI) is a
localized infection of the respiratory and digestive tracts
characterized by mild clinical signs, unless exacerbated by
other infections or environmental conditions. In contrast,
highly pathogenic avian influenza (HPAI) is a systemic
disease characterized by mortality rates that can reach 100%
(for review see Swayne & Halverson, 2003).
Although virulence of avian influenza viruses, as with most
other viruses, is multigenic in nature, the viral haemagglutinin
(HA) is recognized as playing a major role (Rott et al.,
1976; Scholtissek et al., 1977). While HPAI viruses appear
to exclusively express H5 and H7 haemagglutinin subtypes,
not all H5 and H7 viruses are highly pathogenic. The
virulence of H5 and H7 viruses is largely controlled by the
cleavability of the HA precursor, HA0, by host proteases
(Bosch et al., 1979, 1981). Proteolytic cleavage of HA0
generates two disulfide-linked subunits, HA1 andHA2, which
serves to expose a fusion peptide at the newly formed
amino-terminal end of HA2. This fusion peptide is in turn
responsible for the low pH induced fusion of the viral
envelope with host endosomal membranes, necessary for
influenza virus infectivity (Wiley & Skehel, 1987). The HA0
of LPAI viruses is processed by extracellular proteases that
are secreted by cells that line the respiratory and digestive
tracts, while the HA0 of HPAI viruses is processed by a
family of intracellular proteases, which have a broader tissue
distribution. This difference is believed to be the primary
reason why LPAI viruses produce localized infections while
HPAI viruses produce systemic infections.
HPAI H5 and H7 viruses are thought to emerge from low
pathogenic precursors only after the latter have been introduced
into domestic poultry. This hypothesis is supported
by work which demonstrated that HPAI viruses appear not
to form a separate phylogenetic lineage or lineages in
waterfowl, which are the natural reservoirs for all type A
influenza viruses (Banks et al., 2000). Low-pathogenicity
H5 and H7 strains isolated from feral birds typically have
only two basic amino acids at positions 21 and 23 from
the cleavage site (Wood et al., 1993), while HPAI viruses
bear the minimum sequence motif R-X-R/K-R (Vey et al.,
1992). This motif is also found in the cleavage sites of
many proproteins that require cleavage for their activation
(Barr, 1991). Though a number of subtilisin-related
endoproteases cleave proproteins containing this sequence
motif, furin is recognized as the most likely candidate
Supplementary material of the gross and microscopic lesions produced
in experimentally infected chickens can be found in JGV Online.
0008-0478 G 2005 SGM Printed in Great Britain 727
Journal of General Virology (2005), 86, 727–731 DOI 10.1099/vir.0.80478-0
involved in processing the HA0 precursor of HPAI viruses
(Stieneke-Grober et al., 1992).
The emergence of HPAI from LPAI has been proposed to
occur by a number of mechanisms. These include: (i) the
insertion of basic amino acids at the HA cleavage site,
possibly the result of duplication of purine triplets due to
a transcription fault of the polymerase complex (Horimoto
et al., 1995; Garcia et al., 1996), (ii) the progressive accumulation
of basic amino acids at the cleavage site by a stepwise
process involving amino acid substitutions (Horimoto et al.,
1995; Spackman et al., 2003), and (iii) non-homologous
recombination resulting in the insertion of a foreign nucleotide
sequence adjacent to the HA cleavage site (Suarez et al.,
2004).
In February 2004, an outbreak of highly pathogenic avian
influenza arose in a chicken broiler breeder farm in British
Columbia (BC). The index premise was comprised of two
flocks 24 and 52 weeks of age. Birds in the older flock
presented with a mild drop in egg production and feed
consumption, along with a small increase in mortality that
resolved after a few days. Necropsies performed on the
affected birds revealed inflammation of the trachea and
lungs from which an influenza A virus was isolated. The
farm was placed under quarantine pending the results of
virus characterization.
The isolate was subtyped by microtitre plate haemagglutinininhibition
and neuraminidase-inhibition (Van Deusen
et al., 1983) assays as an H7N3. H7-specific primers F, 59-
AGCAAAAGCAGGGGATACAAAATG-39 and G, 59-TCTCCTTGTGCATTTTGATGCC-
39 (Senne et al., 1996) were
used to amplify and sequence a 1158 bp segment of the HA
gene containing the cleavage site. The deduced amino acid
sequence of the cleavage site (PENPKTR/GLF), along with
an intravenous pathogenicity index (IVPI)=0, demonstrated
that this isolate was of low pathogenicity. During the
quarantine period, a pronounced shift in mortality, from
<1 to nearly 20 %, was observed in the younger flock.
Additional tissue specimens were collected from these birds
and an H7N3 virus was once again isolated in chicken
embryos. Total RNA was extracted from allantoic fluid
and used to sequence the HA gene from which a PENPKTR/
GLF cleavage site was deduced. However, these same
allantoic fluid samples induced a cytopathic effect in QT
(Quail fibrosarcoma)-35 cells in the absence of exogenously
added trypsin. Furthermore, systemic disease with high
mortality occurred within the first 24–48 h following
intravenous inoculation of 4-week old specific-pathogenfree
chickens, resulting in an IVPI=2?96. These birds
showed signs of severe depression, laboured breathing,
peri-orbital oedema, cyanosis of the comb and wattles, and
petechial haemorrhages on the scales covering the tarsus
and metatarsus. (Supplementary material of the gross and
microscopic lesions produced in experimentally infected
chickens can be found in JGV Online.) An H7N3 virus was
reisolated from the tissues of these birds and found to
contain a 7 aa insert (PENPKQAYRKRMTR/GLF) at its
haemagglutinin cleavage site. A BLAST search of the nucleotide
sequence of this insert indicated that it most probably
originated from nt 737 to 757 of the matrix gene (M1). The
M1 gene of the original LPAI virus isolate was cloned and
sequenced using primers: 59-BamHI-AGCAAAAGCAGGTAGATATTGAAA-
39 and 59-XbaI-AGTTGAAACAAGGTAGTTTTTACTC-
39. Twenty of 21 nt of the inserted
fragment were identical with that of the corresponding M1
gene sequence (GenBank accession #AY677732).
The contradictory results, involving the pathotype of the
virus isolated from the younger birds on the index farm,
which was initially LPAI based on sequencing, and subsequently
determined to be HPAI based on growth in tissue
culture and IVPI, can be best explained by the presence
of a mixed viral population in which the low pathogenic
form predominated. The existence of mixed influenza virus
populations in a single virus isolate has been described by
others (Perdue et al., 1992, 1994), and is consistent with the
viral quasispecies concept (Domingo & Holland, 1997).
In early March, an H7N3 avian influenza virus was isolated
from a second farm approximately 3 km west of the first.
The only clinical sign observed with birds on this farm was
a sudden increase in mortality. The HA of this isolate
contained the protease cleavage site PENPKQAYQKRMTR/
GLF. In this case the insert was 100% identical with the
corresponding region of the M1 gene. Additional infected
farms were identified by screening cloacal and oropharyngeal
swab specimens for the presence of type A influenza
virus RNA by using a real-time RT-PCR assay which
targeted the M1 gene (Spackman et al., 2002). Specimens
that gave positive results were further processed for virus
isolation in chicken embryos. By the second week of May,
when the last infected farm had been identified, a total of 40
isolates had been characterized, 37 of which contained an
HA cleavage site bearing a 7 aa insert. Sequencing of HA1 for
the majority of these isolates was accomplished by direct
sequencing of RT-PCR amplicons using primers F and G
(Senne et al., 1996). In some instances it was necessary to
clone the RT-PCR amplicons using the pGEM-T-Easy
vector system (Promega). The resulting clones were then
characterized by cycle sequencing using T7/SP6 primers.
Table 1 summarizes the nucleotide and deduced amino
acid sequences of the various isolates, along with their
intravenous pathogenicity indices.
Viruses with QAYKKRM (GenBank accession #AY725855),
QAYHKRM (AY730057), QAYRKRM (AY644402),
QAHQKRM (AY731820) and QACQKRM (AY736323)
inserts most probably evolved from viruses with the
QAYQKRM (AY724684) insert. Three nucleotide changes
were observed within the codon encoding glutamine at
position 4 of the insert, which resulted in substitution with
a basic amino acid at this position. The presence of the
additional basic amino acid at this position did not appear
to significantly alter the virulence of viruses bearing
QAYRKRM and QAYKKRM inserts (Table 1).
728 Journal of General Virology 86
J. Pasick and others
The two most recognized mechanisms responsible for
genetic and phenotypic variation of influenza A viruses
include high mutation rates which give rise to antigenic
drift, and genetic reassortment among different viruses
which gives rise to antigenic shift. RNA recombination has
only recently been considered as a third mechanism by
which influenza A viruses can undergo rapid evolutionary
change. Non-homologous recombination involving influenza
A viruses has been reported rarely in the literature
(Fields & Winter, 1982; Bergman et al., 1992; Khatchikian
et al., 1989;Orlich et al., 1990, 1994; Suarez et al., 2004). Two
reports of non-homologous recombination involving the
haemagglutinin gene are of particular interest with regards
to the BC HPAI outbreak. The first involves a variant of the
H7N3 A/turkey/Oregon/71 that arose following 12 serial
passages in chicken embryo cells in the absence of extracellular
proteases. This variant contained a 54 nt insert
derived from the 28S rRNA gene at the haemagglutinin
cleavage site, which enabled it to be cleaved by intracellular
proteases (Khatchikian et al., 1989). This variant also
demonstrated increased pathogenicity for chickens, inducing
death 4–5 days following intramuscular inoculation
(Orlich et al., 1990). The second report described a nonhomologous
recombinant involving the haemagglutinin
and nucleoprotein genes of the H7N7 A/seal/Massachussetts/
1/80 virus (Orlich et al., 1994). This variant arose following
five serial passages of wild-type virus in chicken embryo cells
in the absence of exogenously added trypsin. Molecular
characterization revealed the presence of a 60 nt insert
corresponding to nt 284–343 of the nucleoprotein gene
(NP) in-frame with, and immediately adjacent to, the
haemagglutinin cleavage site. This insertion mutant demonstrated
a broadened host range with no requirement for
exogenous trypsin, and an increased pathogenicity in White
Leghorn chickens.
The above examples, which demonstrate the ability of influenza
A viruses to utilize non-homologous recombination
to acquire a virulence trait, had, until only recently, been
documented under experimental conditions. The first
report of RNA recombination being responsible for a
shift in virulence in a natural outbreak of avian influenza
involved an H7N3 virus infecting a chicken broiler breeder
flock in Chile in 2002 (Suarez et al., 2004). The time that
elapsed between isolation of the precursor LPAI virus and
the emergence of the HPAI virus was approximately
1 month. Comparison of the low and high pathogenicity
isolates of A/chicken/Chile/02 revealed that all of the high
pathogenicity isolates possessed a 10 aa insert at the HA
cleavage site, which corresponded to nt 1268–1297 of the
nucleoprotein gene. Viruses with the insert grew in chicken
embryo fibroblast cultures without the need for the addition
of trypsin to the media, and had intravenous pathogenicity
indices between 2?43 and 3?00.
The outbreak described in this report is only the second
time that natural emergence of a HPAI virus from a
LPAI virus could be attributed to non-homologous
Table 1. Summary of virus isolates
No. farms Pathotype* IVPI Cleavage siteD Corresponding nucleotide sequenced Isolate no.
24 H 2?17–2?96 PENPKQAYQKRMTR/GLF ccagagaaccccaagcaggcctaccagaaacggatgaccagaggccttttt CN12/04
4 H 3?00 PENPKQAYKKRMTR/GLF ------------------------a-------------------------- NS1337-1/04
3 H ND PENPKQAYHKRMTR/GLF --------------------------t------------------------ NS1319-2/04
1 H 2?95 PENPKQAHQKRMTR/GLF ---------------------c----------------------------- NS1390-2/04
1 H ND PENPRQAYRKRMTR/GLF -------------g-----------g------------------------- NS-1479-1
3 H 2?87–2?96 PENPKQAYRKRMTR/GLF -------------------------g------------------------- CN7-3/04
1 H 2?93 PENPKQACQKRMTR/GLF ----------------------g---------------------------- NS-2035-12/04
3 L 0?00 PENPKTR/GLF --------------- --------------- CN6/04
*Pathotype: H, high pathogenicity; L, low pathogenicity.
DInsert from M1 gene underlined.
dInsert from M1 gene in bold; nucleotide changes underlined.
ND, Not determined.
http://vir.sgmjournals.org 729
Intersegmental recombination of an influenza virus
recombination. Interestingly, all intersegmental recombinants
involving the haemagglutinin that have been
described to date have involved the H7 subtype, and all
insertions have occurred between positions 21 and 22 or
22 and 23 relative to the site of cleavage (Table 2).
Additionally, all have occurred following passage of the
virus in chickens or cells of chicken origin. The mechanism
by which these inserts enhance cleavability by intracellular
proteases is not known. X-ray crystallographic analysis of a
soluble HA0 precursor that is resistant to tryptic cleavage
revealed that the cleavage site forms a nearly circular loop
structure, 19 aa in length, which projects perpendicularly
from the long axis of the haemagglutinin (Chen et al., 1998).
Furthermore, Lys-326 at critical position 24 relative to
where cleavage occurs was not optimally situated for
binding by the furin active site due to its packing against
the HA0 surface. These authors hypothesized that inserts
of basic amino acids that are seen at this site with many of
the highly pathogenic H5 and H7 avian influenza viruses
may cause this loop structure to bulge out further, making
the basic amino acid at critical position 24 more accessible
to the furin active site. The inserts described in this report
and by others (Khatchikian et al., 1989; Orlich et al., 1994;
Suarez et al., 2004) may also enhance cleavage by making
the cleavage site more protease accessible.
In conclusion, a highly pathogenic H7N3 avian influenza
virus appears to have emerged suddenly from a low pathogenic
precursor as a result of a non-homologous recombination
event which took place between the M1 and HA gene
segments. This is only the second field case in which such
a mechanism has been shown to be responsible for the
emergence of a HPAI from a LPAI precursor. Interestingly,
all reports involving non-homologous recombination at
the HA cleavage site have thus far been viruses of the H7
subtype and all have occurred following passage in chickens
or in cells of chicken origin. This outbreak further supports
the opinion that all H7 influenza A virus infections of
domestic poultry should be treated as potentially highly
pathogenic.
Acknowledgements
The authors thank Stacey Halayko, Shanon Toback, Michelle French,
Marlee Ritchie, Lisa Manning, Shelley Ganske and Margaret
Krzyzelewski for their excellent technical assistance. We also thank
the British Columbia Ministry of Agriculture and Food for their
collaboration during the outbreak.
References
Banks, J., Speidel, E. C., McCauley, J. W. & Alexander, D. J. (2000).
Phylogenetic analysis of H7 haemagglutinin subtype influenza A
viruses. Arch Virol 145, 1047–1058.
Barr, P. J. (1991). Mammalian subtilisins: the long-sought dibasic
processing endoproteases. Cell 66, 1–3.
Bergman, M., Garcı´a-Sastre, A. & Palese, P. (1992). Transfectionmediated
recombination of influenza A virus. J Virol 66, 7576–7580.
Bosch, F. X., Orlich, M., Klenck, H.-D. & Rott, R. (1979). The
structure of the hemagglutinin, a determinant for the pathogenicity
of influenza viruses. Virology 95, 197–207.
Bosch, F. X., Garten, W., Klenk, H.-D. & Rott, R. (1981). Proteolytic
cleavage of influenza virus hemagglutinins: primary structure of the
connecting peptide between HA1 and HA2 determines proteolytic
cleavability and pathogenicity of avian influenza viruses. Virology
113, 725–735.
Chen, J., Lee, K. H., Steinhauer, D. A., Stevens, D. J., Skehel, J. J. &
Wiley, D. C. (1998). Structure of the hemagglutinin precursor
cleavage site, a determinant of influenza pathogenicity and the origin
of the labile conformation. Cell 95, 409–417.
Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness
for survival. Annu Rev Microbiol 51, 151–178.
Fields, S. & Winter, G. (1982). Nucleotide sequences of influenza
virus segments 1 and 3 reveal mosaic structure of a small viral RNA
segment. Cell 28, 303–313.
Garcia, M., Crawford, J. M., Latimer, J. W., Rivera-Cruz, E. & Perdue,
M. L. (1996). Heterogeneity in the haemagglutinin gene and emergence
of the highly pathogenic phenotype among recent H5N2 avian
influenza viruses from Mexico. J Gen Virol 77, 1493–1504.
Horimoto, T., Rivera, E., Pearson, J., Senne, D., Krauss, S.,
Kawaoka, Y. & Webster, R. G. (1995). Origin and molecular
changes associated with emergence of a highly pathogenic H5N2
influenza virus in Mexico. Virology 213, 223–230.
Table 2. Comparison of the various inserts that have been introduced into the haemagglutinin cleavage site by nonhomologous
recombination
Inserts are indicated in bold.
Isolate No. amino
acids in insert
Origin
of insert
Amino acid sequence of cleavage site Pathotype* Reference
– – PENPKTR/GLF L
A/Ck/BC/2004 H7N3 7 M1 PENPKQAYQKRMTR/GLF H This study
A/Ck/Chile/2002 H7N3 10 NP PENPKTCSPLSRCRETR/GLF H Suarez et al. (2004)
A/Ty/Oregon/71 H7N3 18 28S rRNA PENPKTSLSPLYPGRTTDLQVPTAR/GLF H Khatchikian et al. (1989)
A/Seal/Mass/1/80 H7N7 20 NP PENPKKEHPSAGKDPKKTGGPIYRRTR/GLF H Orlich et al. (1994)
*Pathotype: H, high pathogenicity; L, low pathogenicity.
730 Journal of General Virology 86
J. Pasick and others
Khatchikian, D., Orlich, M. & Rott, R. (1989). Increased viral pathogenicity
after insertion of a 28S ribosomal RNA sequence into the
haemagglutinin gene of an influenza virus. Nature 340, 156–157.
Orlich, M., Khatchikan, D., Teigler, A. & Rott, R. (1990). Structural
variation occurring in the hemagglutinin of influenza virus A/turkey/
Oregon/71 during adaptation to different cell types. Virology 176,
531–538.
Orlich, M., Gottwald, H. & Rott, R. (1994). Nonhomologous
recombination between the hemagglutinin gene and the nucleoprotein
gene of an influenza virus. Virology 204, 462–465.
Perdue, M. L., Latimer, J., Beck, J. & Brugh, M. (1992). Occurance
and stability of cleavable hemagglutinin in the A/Ck/Pa/21525/83
(H5N2) population of avian influenza virus. In Proceedings of the
3rd International Symposium on Avian Influenza, Madison, WI,
pp. 211–217.
Perdue, M. L., Latimer, J., Greene, C. & Holt, P. (1994). Consistent
occurrence of hemagglutinin variants among avian influenza virus
isolates of the H7 subtype. Virus Res 34, 15–29.
Rott, R., Orlich, M. & Scholtissek, C. (1976). Attenuation of
pathogenicity of fowl plague virus by recombination with other
influenza A viruses nonpathogenic for fowl: nonexclusive dependence
of pathogenicity on hemagglutinin and neuraminidase of the
virus. J Virol 19, 54–60.
Scholtissek, C., Rott, R., Orlich, M., Harms, E. & Rohde, W. (1977).
Correlation of pathogenicity and gene constellation of an influenza A
virus (fowl plague). I. Exchange of a single gene. Virology 81, 74–80.
Senne, D. A., Panigrahy, B., Kawaoka, Y., Pearson, J. E., Su¨ ss, J.,
Lipkind, M., Kida, H. & Webster, R. G. (1996). Survey of the
hemagglutinin (HA) cleavage site sequence of H5 and H7 avian
influenza viruses: amino acid sequence at the HA cleavage site as a
marker of pathogenicity potential. Avian Dis 40, 425–437.
Spackman, E., Senne, D. A., Myers, T. J., Bulaga, L. L., Garber, L. P.,
Perdue, M. L., Lohman, K., Daum, L. T. & Suarez, D. L. (2002).
Development of a real-time reverse transcriptase PCR assay for type
A influenza virus and avian H5 and H7 hemagglutinin subtypes.
J Clin Microbiol 40, 3256–3260.
Spackman, E., Senne, D. A., Davison, S. & Suarez, D. L. (2003).
Sequence analysis of recent H7 influenza viruses associated with
three different outbreaks in commercial poultry in the United States.
J Virol 77, 13399–13402.
Stieneke-Grober, A., Vey, M., Angliker, H., Shaw, E., Thomas, G.,
Roberts, C., Klenk, H.-D. & Garten, W. (1992). Influenza virus
hemagglutinin with multibasic cleavage site is activated by furin, a
subtilisin-like endoprotease. EMBO J 11, 2407–2414.
Suarez, D. L., Senne, D. A., Banks, J. & 11 other authors (2004).
Recombination resulting in virulence shift in avian influenza
outbreak, Chile. Emerg Infect Dis 10, 693–699.
Swayne, D. E. & Halverson, D. A. (2003). Influenza. In Diseases of
Poultry, 11th edn, pp. 135–160. Edited by Y. M. Saif, H. J. Barnes.
J. R. Glisson, A. M. Fadly, L. R. McDougald & D. E. Swayne. Iowa:
Iowa State Press.
Van Deusen, R. A., Hinshaw, V. S., Senne, D. A. &
Pellacani, D. (1983). Micro neuraminidase-inhibition assay for
classification of influenza A virus neuraminidases. Avian Dis 27,
745–750.
Vey, M., Orlich, M., Adler, S., Klenk, H.-D., Rott, R. & Garten, W.
(1992). Hemagglutinin activation of pathogenic avian influenza
viruses of serotype H7 requires the protease recognition motif R-XK/
R-R. Virology 188, 408–413.
Wiley, D. C. & Skehel, J. J. (1987). The structure and function of the
hemagglutinin membrane glycoprotein of influenza virus. Annu Rev
Biochem 56, 365–394.
Wood, G. W., McCauley, J. W., Bashiruddin, J. B. & Alexander, D. J.
(1993). Deduced amino acid sequences at the haemagglutinin
cleavage site of avian influenza A viruses of H5 and H7 subtypes.
Arch Virol 130, 209–217.
http://vir.sgmjournals.org 731
Intersegmental recombination of an influenza virus
Short
Communication
Intersegmental recombination between the
haemagglutinin and matrix genes was responsible
for the emergence of a highly pathogenic H7N3
avian influenza virus in British Columbia
John Pasick,1 Katherine Handel,1 John Robinson,2 John Copps,1
Deidre Ridd,1 Kevin Hills,1 Helen Kehler,1 Colleen Cottam-Birt,1
James Neufeld,1 Yohannes Berhane1 and Stefanie Czub1
Correspondence
John Pasick
[email protected]
1Canadian Food Inspection Agency, National Centre for Foreign Animal Disease, 1015
Arlington Street, Winnipeg, Manitoba, Canada R3E 3M4
2Animal Health Centre, British Columbia Ministry of Agriculture and Food, 1767 Angus
Campbell Road, Abbotsford, British Columbia, Canada V3G 2M3
Received 28 July 2004
Accepted 30 November 2004
In February 2004 a highly pathogenic avian influenza (HPAI) outbreak erupted in British
Columbia. Investigations indicated that the responsible HPAI H7N3 virus emerged suddenly
from a low pathogenic precursor. Analysis of the haemagglutinin (HA) genes of the low and high
pathogenic viruses isolated from the index farm revealed the only difference to be a 21 nt insert
at the HA cleavage site of the highly pathogenic avian influenza virus. It was deduced that this
insert most probably arose as a result of non-homologous recombination between the HA and
matrix genes of the same virus. Over the course of the outbreak, a total of 37 isolates with, and
3 isolates without inserts were characterized. The events described here appear very similar to
those which occurred in Chile in 2002 where the virulence shift of another H7N3 virus was
attributed to non-homologous recombination between the HA and nucleoprotein genes.
Avian influenza manifests itself in domestic poultry in two
distinct ways, depending on the virulence of the strain
involved. Low pathogenic avian influenza (LPAI) is a
localized infection of the respiratory and digestive tracts
characterized by mild clinical signs, unless exacerbated by
other infections or environmental conditions. In contrast,
highly pathogenic avian influenza (HPAI) is a systemic
disease characterized by mortality rates that can reach 100%
(for review see Swayne & Halverson, 2003).
Although virulence of avian influenza viruses, as with most
other viruses, is multigenic in nature, the viral haemagglutinin
(HA) is recognized as playing a major role (Rott et al.,
1976; Scholtissek et al., 1977). While HPAI viruses appear
to exclusively express H5 and H7 haemagglutinin subtypes,
not all H5 and H7 viruses are highly pathogenic. The
virulence of H5 and H7 viruses is largely controlled by the
cleavability of the HA precursor, HA0, by host proteases
(Bosch et al., 1979, 1981). Proteolytic cleavage of HA0
generates two disulfide-linked subunits, HA1 andHA2, which
serves to expose a fusion peptide at the newly formed
amino-terminal end of HA2. This fusion peptide is in turn
responsible for the low pH induced fusion of the viral
envelope with host endosomal membranes, necessary for
influenza virus infectivity (Wiley & Skehel, 1987). The HA0
of LPAI viruses is processed by extracellular proteases that
are secreted by cells that line the respiratory and digestive
tracts, while the HA0 of HPAI viruses is processed by a
family of intracellular proteases, which have a broader tissue
distribution. This difference is believed to be the primary
reason why LPAI viruses produce localized infections while
HPAI viruses produce systemic infections.
HPAI H5 and H7 viruses are thought to emerge from low
pathogenic precursors only after the latter have been introduced
into domestic poultry. This hypothesis is supported
by work which demonstrated that HPAI viruses appear not
to form a separate phylogenetic lineage or lineages in
waterfowl, which are the natural reservoirs for all type A
influenza viruses (Banks et al., 2000). Low-pathogenicity
H5 and H7 strains isolated from feral birds typically have
only two basic amino acids at positions 21 and 23 from
the cleavage site (Wood et al., 1993), while HPAI viruses
bear the minimum sequence motif R-X-R/K-R (Vey et al.,
1992). This motif is also found in the cleavage sites of
many proproteins that require cleavage for their activation
(Barr, 1991). Though a number of subtilisin-related
endoproteases cleave proproteins containing this sequence
motif, furin is recognized as the most likely candidate
Supplementary material of the gross and microscopic lesions produced
in experimentally infected chickens can be found in JGV Online.
0008-0478 G 2005 SGM Printed in Great Britain 727
Journal of General Virology (2005), 86, 727–731 DOI 10.1099/vir.0.80478-0
involved in processing the HA0 precursor of HPAI viruses
(Stieneke-Grober et al., 1992).
The emergence of HPAI from LPAI has been proposed to
occur by a number of mechanisms. These include: (i) the
insertion of basic amino acids at the HA cleavage site,
possibly the result of duplication of purine triplets due to
a transcription fault of the polymerase complex (Horimoto
et al., 1995; Garcia et al., 1996), (ii) the progressive accumulation
of basic amino acids at the cleavage site by a stepwise
process involving amino acid substitutions (Horimoto et al.,
1995; Spackman et al., 2003), and (iii) non-homologous
recombination resulting in the insertion of a foreign nucleotide
sequence adjacent to the HA cleavage site (Suarez et al.,
2004).
In February 2004, an outbreak of highly pathogenic avian
influenza arose in a chicken broiler breeder farm in British
Columbia (BC). The index premise was comprised of two
flocks 24 and 52 weeks of age. Birds in the older flock
presented with a mild drop in egg production and feed
consumption, along with a small increase in mortality that
resolved after a few days. Necropsies performed on the
affected birds revealed inflammation of the trachea and
lungs from which an influenza A virus was isolated. The
farm was placed under quarantine pending the results of
virus characterization.
The isolate was subtyped by microtitre plate haemagglutinininhibition
and neuraminidase-inhibition (Van Deusen
et al., 1983) assays as an H7N3. H7-specific primers F, 59-
AGCAAAAGCAGGGGATACAAAATG-39 and G, 59-TCTCCTTGTGCATTTTGATGCC-
39 (Senne et al., 1996) were
used to amplify and sequence a 1158 bp segment of the HA
gene containing the cleavage site. The deduced amino acid
sequence of the cleavage site (PENPKTR/GLF), along with
an intravenous pathogenicity index (IVPI)=0, demonstrated
that this isolate was of low pathogenicity. During the
quarantine period, a pronounced shift in mortality, from
<1 to nearly 20 %, was observed in the younger flock.
Additional tissue specimens were collected from these birds
and an H7N3 virus was once again isolated in chicken
embryos. Total RNA was extracted from allantoic fluid
and used to sequence the HA gene from which a PENPKTR/
GLF cleavage site was deduced. However, these same
allantoic fluid samples induced a cytopathic effect in QT
(Quail fibrosarcoma)-35 cells in the absence of exogenously
added trypsin. Furthermore, systemic disease with high
mortality occurred within the first 24–48 h following
intravenous inoculation of 4-week old specific-pathogenfree
chickens, resulting in an IVPI=2?96. These birds
showed signs of severe depression, laboured breathing,
peri-orbital oedema, cyanosis of the comb and wattles, and
petechial haemorrhages on the scales covering the tarsus
and metatarsus. (Supplementary material of the gross and
microscopic lesions produced in experimentally infected
chickens can be found in JGV Online.) An H7N3 virus was
reisolated from the tissues of these birds and found to
contain a 7 aa insert (PENPKQAYRKRMTR/GLF) at its
haemagglutinin cleavage site. A BLAST search of the nucleotide
sequence of this insert indicated that it most probably
originated from nt 737 to 757 of the matrix gene (M1). The
M1 gene of the original LPAI virus isolate was cloned and
sequenced using primers: 59-BamHI-AGCAAAAGCAGGTAGATATTGAAA-
39 and 59-XbaI-AGTTGAAACAAGGTAGTTTTTACTC-
39. Twenty of 21 nt of the inserted
fragment were identical with that of the corresponding M1
gene sequence (GenBank accession #AY677732).
The contradictory results, involving the pathotype of the
virus isolated from the younger birds on the index farm,
which was initially LPAI based on sequencing, and subsequently
determined to be HPAI based on growth in tissue
culture and IVPI, can be best explained by the presence
of a mixed viral population in which the low pathogenic
form predominated. The existence of mixed influenza virus
populations in a single virus isolate has been described by
others (Perdue et al., 1992, 1994), and is consistent with the
viral quasispecies concept (Domingo & Holland, 1997).
In early March, an H7N3 avian influenza virus was isolated
from a second farm approximately 3 km west of the first.
The only clinical sign observed with birds on this farm was
a sudden increase in mortality. The HA of this isolate
contained the protease cleavage site PENPKQAYQKRMTR/
GLF. In this case the insert was 100% identical with the
corresponding region of the M1 gene. Additional infected
farms were identified by screening cloacal and oropharyngeal
swab specimens for the presence of type A influenza
virus RNA by using a real-time RT-PCR assay which
targeted the M1 gene (Spackman et al., 2002). Specimens
that gave positive results were further processed for virus
isolation in chicken embryos. By the second week of May,
when the last infected farm had been identified, a total of 40
isolates had been characterized, 37 of which contained an
HA cleavage site bearing a 7 aa insert. Sequencing of HA1 for
the majority of these isolates was accomplished by direct
sequencing of RT-PCR amplicons using primers F and G
(Senne et al., 1996). In some instances it was necessary to
clone the RT-PCR amplicons using the pGEM-T-Easy
vector system (Promega). The resulting clones were then
characterized by cycle sequencing using T7/SP6 primers.
Table 1 summarizes the nucleotide and deduced amino
acid sequences of the various isolates, along with their
intravenous pathogenicity indices.
Viruses with QAYKKRM (GenBank accession #AY725855),
QAYHKRM (AY730057), QAYRKRM (AY644402),
QAHQKRM (AY731820) and QACQKRM (AY736323)
inserts most probably evolved from viruses with the
QAYQKRM (AY724684) insert. Three nucleotide changes
were observed within the codon encoding glutamine at
position 4 of the insert, which resulted in substitution with
a basic amino acid at this position. The presence of the
additional basic amino acid at this position did not appear
to significantly alter the virulence of viruses bearing
QAYRKRM and QAYKKRM inserts (Table 1).
728 Journal of General Virology 86
J. Pasick and others
The two most recognized mechanisms responsible for
genetic and phenotypic variation of influenza A viruses
include high mutation rates which give rise to antigenic
drift, and genetic reassortment among different viruses
which gives rise to antigenic shift. RNA recombination has
only recently been considered as a third mechanism by
which influenza A viruses can undergo rapid evolutionary
change. Non-homologous recombination involving influenza
A viruses has been reported rarely in the literature
(Fields & Winter, 1982; Bergman et al., 1992; Khatchikian
et al., 1989;Orlich et al., 1990, 1994; Suarez et al., 2004). Two
reports of non-homologous recombination involving the
haemagglutinin gene are of particular interest with regards
to the BC HPAI outbreak. The first involves a variant of the
H7N3 A/turkey/Oregon/71 that arose following 12 serial
passages in chicken embryo cells in the absence of extracellular
proteases. This variant contained a 54 nt insert
derived from the 28S rRNA gene at the haemagglutinin
cleavage site, which enabled it to be cleaved by intracellular
proteases (Khatchikian et al., 1989). This variant also
demonstrated increased pathogenicity for chickens, inducing
death 4–5 days following intramuscular inoculation
(Orlich et al., 1990). The second report described a nonhomologous
recombinant involving the haemagglutinin
and nucleoprotein genes of the H7N7 A/seal/Massachussetts/
1/80 virus (Orlich et al., 1994). This variant arose following
five serial passages of wild-type virus in chicken embryo cells
in the absence of exogenously added trypsin. Molecular
characterization revealed the presence of a 60 nt insert
corresponding to nt 284–343 of the nucleoprotein gene
(NP) in-frame with, and immediately adjacent to, the
haemagglutinin cleavage site. This insertion mutant demonstrated
a broadened host range with no requirement for
exogenous trypsin, and an increased pathogenicity in White
Leghorn chickens.
The above examples, which demonstrate the ability of influenza
A viruses to utilize non-homologous recombination
to acquire a virulence trait, had, until only recently, been
documented under experimental conditions. The first
report of RNA recombination being responsible for a
shift in virulence in a natural outbreak of avian influenza
involved an H7N3 virus infecting a chicken broiler breeder
flock in Chile in 2002 (Suarez et al., 2004). The time that
elapsed between isolation of the precursor LPAI virus and
the emergence of the HPAI virus was approximately
1 month. Comparison of the low and high pathogenicity
isolates of A/chicken/Chile/02 revealed that all of the high
pathogenicity isolates possessed a 10 aa insert at the HA
cleavage site, which corresponded to nt 1268–1297 of the
nucleoprotein gene. Viruses with the insert grew in chicken
embryo fibroblast cultures without the need for the addition
of trypsin to the media, and had intravenous pathogenicity
indices between 2?43 and 3?00.
The outbreak described in this report is only the second
time that natural emergence of a HPAI virus from a
LPAI virus could be attributed to non-homologous
Table 1. Summary of virus isolates
No. farms Pathotype* IVPI Cleavage siteD Corresponding nucleotide sequenced Isolate no.
24 H 2?17–2?96 PENPKQAYQKRMTR/GLF ccagagaaccccaagcaggcctaccagaaacggatgaccagaggccttttt CN12/04
4 H 3?00 PENPKQAYKKRMTR/GLF ------------------------a-------------------------- NS1337-1/04
3 H ND PENPKQAYHKRMTR/GLF --------------------------t------------------------ NS1319-2/04
1 H 2?95 PENPKQAHQKRMTR/GLF ---------------------c----------------------------- NS1390-2/04
1 H ND PENPRQAYRKRMTR/GLF -------------g-----------g------------------------- NS-1479-1
3 H 2?87–2?96 PENPKQAYRKRMTR/GLF -------------------------g------------------------- CN7-3/04
1 H 2?93 PENPKQACQKRMTR/GLF ----------------------g---------------------------- NS-2035-12/04
3 L 0?00 PENPKTR/GLF --------------- --------------- CN6/04
*Pathotype: H, high pathogenicity; L, low pathogenicity.
DInsert from M1 gene underlined.
dInsert from M1 gene in bold; nucleotide changes underlined.
ND, Not determined.
http://vir.sgmjournals.org 729
Intersegmental recombination of an influenza virus
recombination. Interestingly, all intersegmental recombinants
involving the haemagglutinin that have been
described to date have involved the H7 subtype, and all
insertions have occurred between positions 21 and 22 or
22 and 23 relative to the site of cleavage (Table 2).
Additionally, all have occurred following passage of the
virus in chickens or cells of chicken origin. The mechanism
by which these inserts enhance cleavability by intracellular
proteases is not known. X-ray crystallographic analysis of a
soluble HA0 precursor that is resistant to tryptic cleavage
revealed that the cleavage site forms a nearly circular loop
structure, 19 aa in length, which projects perpendicularly
from the long axis of the haemagglutinin (Chen et al., 1998).
Furthermore, Lys-326 at critical position 24 relative to
where cleavage occurs was not optimally situated for
binding by the furin active site due to its packing against
the HA0 surface. These authors hypothesized that inserts
of basic amino acids that are seen at this site with many of
the highly pathogenic H5 and H7 avian influenza viruses
may cause this loop structure to bulge out further, making
the basic amino acid at critical position 24 more accessible
to the furin active site. The inserts described in this report
and by others (Khatchikian et al., 1989; Orlich et al., 1994;
Suarez et al., 2004) may also enhance cleavage by making
the cleavage site more protease accessible.
In conclusion, a highly pathogenic H7N3 avian influenza
virus appears to have emerged suddenly from a low pathogenic
precursor as a result of a non-homologous recombination
event which took place between the M1 and HA gene
segments. This is only the second field case in which such
a mechanism has been shown to be responsible for the
emergence of a HPAI from a LPAI precursor. Interestingly,
all reports involving non-homologous recombination at
the HA cleavage site have thus far been viruses of the H7
subtype and all have occurred following passage in chickens
or in cells of chicken origin. This outbreak further supports
the opinion that all H7 influenza A virus infections of
domestic poultry should be treated as potentially highly
pathogenic.
Acknowledgements
The authors thank Stacey Halayko, Shanon Toback, Michelle French,
Marlee Ritchie, Lisa Manning, Shelley Ganske and Margaret
Krzyzelewski for their excellent technical assistance. We also thank
the British Columbia Ministry of Agriculture and Food for their
collaboration during the outbreak.
References
Banks, J., Speidel, E. C., McCauley, J. W. & Alexander, D. J. (2000).
Phylogenetic analysis of H7 haemagglutinin subtype influenza A
viruses. Arch Virol 145, 1047–1058.
Barr, P. J. (1991). Mammalian subtilisins: the long-sought dibasic
processing endoproteases. Cell 66, 1–3.
Bergman, M., Garcı´a-Sastre, A. & Palese, P. (1992). Transfectionmediated
recombination of influenza A virus. J Virol 66, 7576–7580.
Bosch, F. X., Orlich, M., Klenck, H.-D. & Rott, R. (1979). The
structure of the hemagglutinin, a determinant for the pathogenicity
of influenza viruses. Virology 95, 197–207.
Bosch, F. X., Garten, W., Klenk, H.-D. & Rott, R. (1981). Proteolytic
cleavage of influenza virus hemagglutinins: primary structure of the
connecting peptide between HA1 and HA2 determines proteolytic
cleavability and pathogenicity of avian influenza viruses. Virology
113, 725–735.
Chen, J., Lee, K. H., Steinhauer, D. A., Stevens, D. J., Skehel, J. J. &
Wiley, D. C. (1998). Structure of the hemagglutinin precursor
cleavage site, a determinant of influenza pathogenicity and the origin
of the labile conformation. Cell 95, 409–417.
Domingo, E. & Holland, J. J. (1997). RNA virus mutations and fitness
for survival. Annu Rev Microbiol 51, 151–178.
Fields, S. & Winter, G. (1982). Nucleotide sequences of influenza
virus segments 1 and 3 reveal mosaic structure of a small viral RNA
segment. Cell 28, 303–313.
Garcia, M., Crawford, J. M., Latimer, J. W., Rivera-Cruz, E. & Perdue,
M. L. (1996). Heterogeneity in the haemagglutinin gene and emergence
of the highly pathogenic phenotype among recent H5N2 avian
influenza viruses from Mexico. J Gen Virol 77, 1493–1504.
Horimoto, T., Rivera, E., Pearson, J., Senne, D., Krauss, S.,
Kawaoka, Y. & Webster, R. G. (1995). Origin and molecular
changes associated with emergence of a highly pathogenic H5N2
influenza virus in Mexico. Virology 213, 223–230.
Table 2. Comparison of the various inserts that have been introduced into the haemagglutinin cleavage site by nonhomologous
recombination
Inserts are indicated in bold.
Isolate No. amino
acids in insert
Origin
of insert
Amino acid sequence of cleavage site Pathotype* Reference
– – PENPKTR/GLF L
A/Ck/BC/2004 H7N3 7 M1 PENPKQAYQKRMTR/GLF H This study
A/Ck/Chile/2002 H7N3 10 NP PENPKTCSPLSRCRETR/GLF H Suarez et al. (2004)
A/Ty/Oregon/71 H7N3 18 28S rRNA PENPKTSLSPLYPGRTTDLQVPTAR/GLF H Khatchikian et al. (1989)
A/Seal/Mass/1/80 H7N7 20 NP PENPKKEHPSAGKDPKKTGGPIYRRTR/GLF H Orlich et al. (1994)
*Pathotype: H, high pathogenicity; L, low pathogenicity.
730 Journal of General Virology 86
J. Pasick and others
Khatchikian, D., Orlich, M. & Rott, R. (1989). Increased viral pathogenicity
after insertion of a 28S ribosomal RNA sequence into the
haemagglutinin gene of an influenza virus. Nature 340, 156–157.
Orlich, M., Khatchikan, D., Teigler, A. & Rott, R. (1990). Structural
variation occurring in the hemagglutinin of influenza virus A/turkey/
Oregon/71 during adaptation to different cell types. Virology 176,
531–538.
Orlich, M., Gottwald, H. & Rott, R. (1994). Nonhomologous
recombination between the hemagglutinin gene and the nucleoprotein
gene of an influenza virus. Virology 204, 462–465.
Perdue, M. L., Latimer, J., Beck, J. & Brugh, M. (1992). Occurance
and stability of cleavable hemagglutinin in the A/Ck/Pa/21525/83
(H5N2) population of avian influenza virus. In Proceedings of the
3rd International Symposium on Avian Influenza, Madison, WI,
pp. 211–217.
Perdue, M. L., Latimer, J., Greene, C. & Holt, P. (1994). Consistent
occurrence of hemagglutinin variants among avian influenza virus
isolates of the H7 subtype. Virus Res 34, 15–29.
Rott, R., Orlich, M. & Scholtissek, C. (1976). Attenuation of
pathogenicity of fowl plague virus by recombination with other
influenza A viruses nonpathogenic for fowl: nonexclusive dependence
of pathogenicity on hemagglutinin and neuraminidase of the
virus. J Virol 19, 54–60.
Scholtissek, C., Rott, R., Orlich, M., Harms, E. & Rohde, W. (1977).
Correlation of pathogenicity and gene constellation of an influenza A
virus (fowl plague). I. Exchange of a single gene. Virology 81, 74–80.
Senne, D. A., Panigrahy, B., Kawaoka, Y., Pearson, J. E., Su¨ ss, J.,
Lipkind, M., Kida, H. & Webster, R. G. (1996). Survey of the
hemagglutinin (HA) cleavage site sequence of H5 and H7 avian
influenza viruses: amino acid sequence at the HA cleavage site as a
marker of pathogenicity potential. Avian Dis 40, 425–437.
Spackman, E., Senne, D. A., Myers, T. J., Bulaga, L. L., Garber, L. P.,
Perdue, M. L., Lohman, K., Daum, L. T. & Suarez, D. L. (2002).
Development of a real-time reverse transcriptase PCR assay for type
A influenza virus and avian H5 and H7 hemagglutinin subtypes.
J Clin Microbiol 40, 3256–3260.
Spackman, E., Senne, D. A., Davison, S. & Suarez, D. L. (2003).
Sequence analysis of recent H7 influenza viruses associated with
three different outbreaks in commercial poultry in the United States.
J Virol 77, 13399–13402.
Stieneke-Grober, A., Vey, M., Angliker, H., Shaw, E., Thomas, G.,
Roberts, C., Klenk, H.-D. & Garten, W. (1992). Influenza virus
hemagglutinin with multibasic cleavage site is activated by furin, a
subtilisin-like endoprotease. EMBO J 11, 2407–2414.
Suarez, D. L., Senne, D. A., Banks, J. & 11 other authors (2004).
Recombination resulting in virulence shift in avian influenza
outbreak, Chile. Emerg Infect Dis 10, 693–699.
Swayne, D. E. & Halverson, D. A. (2003). Influenza. In Diseases of
Poultry, 11th edn, pp. 135–160. Edited by Y. M. Saif, H. J. Barnes.
J. R. Glisson, A. M. Fadly, L. R. McDougald & D. E. Swayne. Iowa:
Iowa State Press.
Van Deusen, R. A., Hinshaw, V. S., Senne, D. A. &
Pellacani, D. (1983). Micro neuraminidase-inhibition assay for
classification of influenza A virus neuraminidases. Avian Dis 27,
745–750.
Vey, M., Orlich, M., Adler, S., Klenk, H.-D., Rott, R. & Garten, W.
(1992). Hemagglutinin activation of pathogenic avian influenza
viruses of serotype H7 requires the protease recognition motif R-XK/
R-R. Virology 188, 408–413.
Wiley, D. C. & Skehel, J. J. (1987). The structure and function of the
hemagglutinin membrane glycoprotein of influenza virus. Annu Rev
Biochem 56, 365–394.
Wood, G. W., McCauley, J. W., Bashiruddin, J. B. & Alexander, D. J.
(1993). Deduced amino acid sequences at the haemagglutinin
cleavage site of avian influenza A viruses of H5 and H7 subtypes.
Arch Virol 130, 209–217.
http://vir.sgmjournals.org 731
Intersegmental recombination of an influenza virus